View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4543_low_31 (Length: 223)
Name: NF4543_low_31
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4543_low_31 |
 | |
|
| [»] scaffold0067 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0067 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: scaffold0067
Description:
Target: scaffold0067; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 39682 - 39598
Alignment:
| Q |
19 |
tgtgcaccgtaactcaaatgagttggtacttgttaaacattcagggatgaaaatgactattcgtccatgtttttaggagtagata |
103 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39682 |
tgtgcaccgtacctcaaatgagttggtactcgttaaacattcagggatgaaaatgactatttgtccatgtttttaggagtagata |
39598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2189 times since January 2019
Visitors: 8677