View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4543_low_32 (Length: 222)
Name: NF4543_low_32
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4543_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 47043700 - 47043557
Alignment:
| Q |
1 |
tcatcaagtagccacaccgtagttgttgtagttgcaagttggacgtctctaactttaactctcaggttttggaatttgttataatgatgactattttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47043700 |
tcatcaagtagccacaccgtagttgttgtagttgcaagttggacgtctctaactttaactctcaggttttggaatttgttataatgatgactattttttg |
47043601 |
T |
|
| Q |
101 |
tatttatgaatgttattttcagtttaaatagaagattattcttt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47043600 |
tatttatgaatgttattttcagtttaaatagaagattattcttt |
47043557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 175 - 222
Target Start/End: Complemental strand, 47043528 - 47043481
Alignment:
| Q |
175 |
gtcaggactacatttttattttatcaatgcatatttttactatgataa |
222 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47043528 |
gtcaggattacatttttattttatcaatgcatatttttactatgataa |
47043481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 144
Target Start/End: Complemental strand, 17902328 - 17902294
Alignment:
| Q |
110 |
atgttattttcagtttaaatagaagattattcttt |
144 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
17902328 |
atgttattttcaatttaaatagaagattattcttt |
17902294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 1112536 - 1112500
Alignment:
| Q |
108 |
gaatgttattttcagtttaaatagaagattattcttt |
144 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
1112536 |
gaatgttattttcaatttaaatagaagattaatcttt |
1112500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 111 - 144
Target Start/End: Complemental strand, 23688420 - 23688387
Alignment:
| Q |
111 |
tgttattttcagtttaaatagaagattattcttt |
144 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
23688420 |
tgttattttcaatttaaatagaagattattcttt |
23688387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2307 times since January 2019
Visitors: 8690