View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4543_low_34 (Length: 201)
Name: NF4543_low_34
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4543_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 3e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 137 - 190
Target Start/End: Complemental strand, 43380162 - 43380109
Alignment:
| Q |
137 |
cttaatcatgtagagaacatgggggacatacaacatctcacccgaacctttcat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43380162 |
cttaatcatgtagagaacatgggggacatacaacatctcacccgaacctttcat |
43380109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 23 - 72
Target Start/End: Complemental strand, 43380277 - 43380228
Alignment:
| Q |
23 |
aatattttagtatcaacttatcataaataatgctgtagactctctttgat |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43380277 |
aatattttagtatcaacttatcataaataatgctgtagactctctttgat |
43380228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4115 times since January 2019
Visitors: 8754