View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4543_low_9 (Length: 346)
Name: NF4543_low_9
Description: NF4543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4543_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 32 - 252
Target Start/End: Complemental strand, 28421950 - 28421728
Alignment:
| Q |
32 |
tcctgtttattactggatgatgctatgatttatgagtctagctagggactcttgggtgttgaattttattataatggtttcaaata--acacataaagga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28421950 |
tcctgtttattactggatgatgctatgatttatgagtctagctagggactcttgggtgttgaattttattataatggtttcaaatataacacataaagga |
28421851 |
T |
|
| Q |
130 |
gaattctttaattgatgttctgaaatggatttgtcttcaagtgtttggatgatattagattcctatcaccccactattgaatatcttcagagaacgagat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28421850 |
gaattctttaattgatgttctgaaatggatttgtcttcaagtgtttggatgatattagattcctatcaccccactattgaatatcttcagagaacgagat |
28421751 |
T |
|
| Q |
230 |
ctttcactcccttgtccttttcc |
252 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28421750 |
ctttcactcccttgtccttttcc |
28421728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2988 times since January 2019
Visitors: 8641