View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4545-Insertion-10 (Length: 128)
Name: NF4545-Insertion-10
Description: NF4545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4545-Insertion-10 |
| |
|
[»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 7 - 128
Target Start/End: Original strand, 32148568 - 32148689
Alignment:
Q |
7 |
atatggaacaaccatgtcactagaagtttgaataattgtgcatggagtttcaactttctcaagtatatctctatagtcatggcaaaacactgttttggct |
106 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32148568 |
atatggaacaaccatgtcactagaggtttgaataattgtgcatggagtttcaactttctcaagtatatctctatagtcatggcaaaacactgttttggct |
32148667 |
T |
|
Q |
107 |
aaggacaatggaacttcatttc |
128 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
32148668 |
aaggacaatggaacttcatttc |
32148689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3801 times since January 2019
Visitors: 8728