View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4545-Insertion-11 (Length: 116)
Name: NF4545-Insertion-11
Description: NF4545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4545-Insertion-11 |
| |
|
[»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 8 - 116
Target Start/End: Complemental strand, 39264328 - 39264220
Alignment:
Q |
8 |
agaaatccatcccagttccagtcttattgatgatatcttcatcaattactttagattgttgaaagagctgttgcaaagtgaacttaccacttttatcgtc |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39264328 |
agaaatccatcccagttccagtcttattgatgatatcttcatcaattactttagattgttgaaagagctgttgcaaagtgaacttaccacttttatcgtc |
39264229 |
T |
|
Q |
108 |
accttgttg |
116 |
Q |
|
|
||||||||| |
|
|
T |
39264228 |
accttgttg |
39264220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3980 times since January 2019
Visitors: 8743