View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4545-Insertion-7 (Length: 178)
Name: NF4545-Insertion-7
Description: NF4545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4545-Insertion-7 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 355635 - 355465
Alignment:
| Q |
8 |
ttactcatatgcttgacctctactgatgctccagcatctgagttaacggtatccagttcttgaaccacattgtgaacttcaggattattacaggtcaggt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
355635 |
ttactcatatgcttgacctctactgatgctccagcatctgagttaacggtatccagttcttgaaccacattgtgaacttcatgattattacaggtcaggt |
355536 |
T |
|
| Q |
108 |
tttcagttcgaccaacatcagactgaacatcaaaggcagtgccagcaccaatatcagaaaaatgatgcata |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
355535 |
tttcagttcgaccaacatcagactgaacatcaaaggcagtgccagcaccaatatcagaaaaatgatgcata |
355465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 10582018 - 10581849
Alignment:
| Q |
8 |
ttactcatatgcttgacctctactgatgctccagcatctgagttaacggtatccagttcttgaaccacattgtgaacttcaggattattacaggtcaggt |
107 |
Q |
| |
|
|||||||| | |||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10582018 |
ttactcatgtacttgacctctactgatactccagcatctgagttaacagtatc-agttcttgaaccacattgagaacttcaggattattacaggtcaggt |
10581920 |
T |
|
| Q |
108 |
tttcagttcgaccaacatcagactgaacatcaaaggcagtgccagcaccaatatcagaaaaatgatgcata |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10581919 |
tttcagttcgaccaacatcagactgaacatcataggcagtaccagcaccaatatcagaaaaatgatgcata |
10581849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3847 times since January 2019
Visitors: 8728