View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4545-Insertion-9 (Length: 129)
Name: NF4545-Insertion-9
Description: NF4545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4545-Insertion-9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 128
Target Start/End: Original strand, 4215954 - 4216074
Alignment:
| Q |
8 |
gtaatcccccagctgaaggtggtgataggccaacagctcaaatccttccatgattgaagattgtggccatgcatgcatagtttgtgtaccattgatatct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4215954 |
gtaatcccccagctgaaggtggtgatagtccaacagctcaaatccttccatgattgaagattgtggccatgcatgcatagtttgtgtaccattgatatct |
4216053 |
T |
|
| Q |
108 |
ttacatttatatatgtattat |
128 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4216054 |
atacatttatatatgtattat |
4216074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2174 times since January 2019
Visitors: 8677