View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4545_high_14 (Length: 214)
Name: NF4545_high_14
Description: NF4545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4545_high_14 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 201
Target Start/End: Complemental strand, 42871095 - 42870913
Alignment:
Q |
19 |
atatttcatcaactattagctcatatcacagacacagtaatatcatgcctcgggtgattgctgattacagccgctatcccaaattgtttatctttgggga |
118 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42871095 |
atatttcatcaactattagctcatatcacagacacagtaatatcatgtctcgggtgattgctgattacagccgctatcccaaattgtttatctttgggga |
42870996 |
T |
|
Q |
119 |
aacaaaaataaatttcaaccaattgcaatattcgtcagccgatcgcagaatttgatattagtacaaagactgatagaataatc |
201 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42870995 |
aacaaaaataaatttcaaccaattgcaatactcgtcagccgatcgcagaatttgatattagtacaaagactgatagaataatc |
42870913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3612 times since January 2019
Visitors: 8709