View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4547-Insertion-6 (Length: 142)
Name: NF4547-Insertion-6
Description: NF4547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4547-Insertion-6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 6e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 6e-69
Query Start/End: Original strand, 7 - 142
Target Start/End: Complemental strand, 45347490 - 45347355
Alignment:
| Q |
7 |
aggaaggaaggaagagtcaaattgagataggttgacaagcaaaggttttatttgtagtgttaaaactaacaaggaaaatgaatgagaggtaatggcttca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45347490 |
aggaaggaaggaagagtcaaattgagataggttgacaagcaaaggttttatttgtagcgttaaaactaacaaggaaaatgaatgagaggtaatggcttca |
45347391 |
T |
|
| Q |
107 |
caattgcatggtaccatcaacgtgttcgaccctctt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45347390 |
caattgcatggtaccatcaacgtgttcgaccctctt |
45347355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4248 times since January 2019
Visitors: 8757