View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4547-Insertion-8 (Length: 117)
Name: NF4547-Insertion-8
Description: NF4547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4547-Insertion-8 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 5e-38; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 5e-38
Query Start/End: Original strand, 8 - 116
Target Start/End: Complemental strand, 27173288 - 27173180
Alignment:
Q |
8 |
gaaggttgaatcctttgatgtgtttaaatgcagtttcctaagtttttcttctattgctgcgtttgcagtgannnnnnngtataacatactttgactcttt |
107 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
27173288 |
gaagattgaatcctttgatgtgtttaaatgcagtttcctaagtttttcttctattgctgcgtttgcagtgatttttttgtgtaacatactttgactcttt |
27173189 |
T |
|
Q |
108 |
gtttctcca |
116 |
Q |
|
|
||||||||| |
|
|
T |
27173188 |
gtttctcca |
27173180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 29669160 - 29669120
Alignment:
Q |
14 |
tgaatcctttgatgtgtttaaatgcagtttcctaagttttt |
54 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
29669160 |
tgaatcctttgatgtgtttaaatgcagttttttaagttttt |
29669120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 10258533 - 10258489
Alignment:
Q |
10 |
aggttgaatcctttgatgtgtttaaatgcagtttcctaagttttt |
54 |
Q |
|
|
|||||||||| |||||| |||||||| ||| |||||||||||||| |
|
|
T |
10258533 |
aggttgaatcatttgatatgtttaaaggcaatttcctaagttttt |
10258489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4290 times since January 2019
Visitors: 8757