View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4547_high_5 (Length: 324)
Name: NF4547_high_5
Description: NF4547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4547_high_5 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 39846173 - 39845880
Alignment:
Q |
1 |
atttatgcaaacgtcttctccaaggcagatggcacaaaacatggttgcgttgtcgattcaagatgtcaaaagaatggaatcttatatccaattagaatta |
100 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39846173 |
atttatgcaaacttcttctccaaggcagatggcacaaaacatggttgcgttgtcgattcaagatgtcaaaagaatggaatcttatatccaattagaatta |
39846074 |
T |
|
Q |
101 |
gctttgttattgatgcaaaagtcagaggccatgaatgagttacaagtggcatatatgtctggttattcacaaggaaaccatacatccaaggcatggcaaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39846073 |
gctttgttattgatgcaaaagtcagaggccatgaatgagttacaagtggcatatatgtctggttattcacaaggaaaccatacatccaaggcatggcaaa |
39845974 |
T |
|
Q |
201 |
gcttaccatgaactagagtctagagatgtcaactcggcatggcataggtggggagcatcaagatataaaagttagttatacttatactagttag |
294 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
T |
39845973 |
gcttaccatgaactagagtctagagatgtcaactcggcatggcagaggaggggagcatcaagatataaaagttacttatgcttatactagttag |
39845880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3968 times since January 2019
Visitors: 8743