View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4547_high_6 (Length: 259)
Name: NF4547_high_6
Description: NF4547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4547_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 38 - 147
Target Start/End: Original strand, 7034991 - 7035100
Alignment:
| Q |
38 |
tagcaacataactgtaatattgactggactaagtcggtactcattagtcaagtcatcaacagggcttaatctgatatctagcttgttgaatgcagctata |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7034991 |
tagcaacataactgtaatattgactggactaagtcggtactcattagtcaagtcatcaacagggcttaatctgatatctagcttgttgaatgcagctata |
7035090 |
T |
|
| Q |
138 |
atttaaagtc |
147 |
Q |
| |
|
|||||||||| |
|
|
| T |
7035091 |
atttaaagtc |
7035100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 205 - 247
Target Start/End: Original strand, 7035151 - 7035193
Alignment:
| Q |
205 |
atgcagatatccagtagtagcataagtttatttgttcatctca |
247 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
7035151 |
atgcagatatcctgtagtagcataagtttatttgtttatctca |
7035193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3508 times since January 2019
Visitors: 8698