View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4547_low_10 (Length: 252)
Name: NF4547_low_10
Description: NF4547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4547_low_10 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 52564351 - 52564115
Alignment:
Q |
1 |
tttgtcatattattagatgtatatcatcaacttaattatctaagtctttcttattttaatcataagttgattttaaaataaatataacttgtatgtgcat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52564351 |
tttgtcatattattagatgtatatcatcaacttaattatctaagtctttcttattttaatcataagttgattttaaaataaatataacttgtatgtgcat |
52564252 |
T |
|
Q |
101 |
atatttttagtctcctaaaattatcaatttagatttgcctacaccttaag---agaaaaacatgcttttcgtatacggcttcatgaacacactccgaaaa |
197 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||||| ||| |||||||||||||||||||||||||| |
|
|
T |
52564251 |
atatttttagtctcctaaaattatcaatttagacttgcctacaccttaagatcagataaacatgctttttgtagacggcttcatgaacacactccgaaaa |
52564152 |
T |
|
Q |
198 |
caaaagagataaacacaatctcttgatggagttggta |
234 |
Q |
|
|
||||||||||||||||||| |||||||||||| |||| |
|
|
T |
52564151 |
caaaagagataaacacaatttcttgatggagtcggta |
52564115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3932 times since January 2019
Visitors: 8743