View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4547_low_13 (Length: 245)
Name: NF4547_low_13
Description: NF4547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4547_low_13 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 238
Target Start/End: Original strand, 45347721 - 45347946
Alignment:
Q |
13 |
taactgaagggagagggagaaagatatatggtaggttcgacacataacggagggggagatagcggtaagtcatggagggaagaactcctcggactgcgaa |
112 |
Q |
|
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||| | || |
|
|
T |
45347721 |
taacttaagggagagggagagagatatatggtaggttcgacacataacggagggggagatagcggtaagtcattgatggaagacctcctcggacttctaa |
45347820 |
T |
|
Q |
113 |
ggatccacattaagcgtggcgtcaacctcgccgttcgtgatgttaatactagtgatccatatgccgtcgttaagatgggcaagcaggttatctttctatt |
212 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45347821 |
ggatccgcattaagcgtggcgtcaacctcgccgttcgtgatgttaatactagtgatccatatgccgtcgttaagatgggcaagcaggttatctttctatt |
45347920 |
T |
|
Q |
213 |
tccatcatcctaagttccttcctttg |
238 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
45347921 |
tccatcatcctaagttccttcctttg |
45347946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2698 times since January 2019
Visitors: 8577