View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4547_low_15 (Length: 228)
Name: NF4547_low_15
Description: NF4547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4547_low_15 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 225
Target Start/End: Original strand, 45347485 - 45347706
Alignment:
Q |
7 |
cttccttcctgtgtgcctcacaacttacacataatctctccctcccaacccgaggattcaaatatttacctgtcaactttctataacaaccacctgaaat |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
45347485 |
cttccttcctgtgtgcctcacaacttacacataatctctcccccccaacccgaggattcaaatatttaactgtcaactttctataacaaccacctgaaat |
45347584 |
T |
|
Q |
107 |
aaccgaattctggtgggctcattgttcaa---tattgtttcattttccaattttggattattatttgatggtagttaatcatgaatcattttgacttgtt |
203 |
Q |
|
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
45347585 |
aaccgaactctggtgggctcattgttcaatattattgtttcattttccaatttttaattattatttgatggtagttaatcatgaatcattctgacttgtt |
45347684 |
T |
|
Q |
204 |
tctattttttgcagtgtaaaag |
225 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
45347685 |
tctattttttgcagtgtaaaag |
45347706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3397 times since January 2019
Visitors: 8687