View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4547_low_16 (Length: 208)
Name: NF4547_low_16
Description: NF4547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4547_low_16 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 489221 - 489046
Alignment:
Q |
18 |
aattgatagtaacaccactaggagctggaaacgaagtaggtagatcatgcgtttacatgacctacaaaggaaaaaccgttttattcgattgcggtattca |
117 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
489221 |
aattgatagtaacaccattaggagctggaaacgaagtaggtagatcatgcgtttacatgacctacaaaggaaaaaccgttttattcgattgcggtattca |
489122 |
T |
|
Q |
118 |
tcctggttactccggcatggcggcgcttccttacttcgatgaaatcgatccttcaactgtcgacgttcttctcatt |
193 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
489121 |
tcctggttactccggcatggcggcgcttccttacttcgatgaaatcgatccttcaactgtcgacgttcttctcatt |
489046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3811 times since January 2019
Visitors: 8728