View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4547_low_16 (Length: 208)

Name: NF4547_low_16
Description: NF4547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4547_low_16
NF4547_low_16
[»] chr2 (1 HSPs)
chr2 (18-193)||(489046-489221)


Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 489221 - 489046
Alignment:
18 aattgatagtaacaccactaggagctggaaacgaagtaggtagatcatgcgtttacatgacctacaaaggaaaaaccgttttattcgattgcggtattca 117  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
489221 aattgatagtaacaccattaggagctggaaacgaagtaggtagatcatgcgtttacatgacctacaaaggaaaaaccgttttattcgattgcggtattca 489122  T
118 tcctggttactccggcatggcggcgcttccttacttcgatgaaatcgatccttcaactgtcgacgttcttctcatt 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
489121 tcctggttactccggcatggcggcgcttccttacttcgatgaaatcgatccttcaactgtcgacgttcttctcatt 489046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3811 times since January 2019
Visitors: 8728