View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4547_low_7 (Length: 301)
Name: NF4547_low_7
Description: NF4547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4547_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 202 - 287
Target Start/End: Original strand, 4695840 - 4695925
Alignment:
| Q |
202 |
catgatatatttgccaccatgagaaattttgctttcgttcgattgagtatgcttgatatgaacgtattattaggcttattgttgat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
4695840 |
catgatatatttgccaccatgagaaattttgctttcgttcgattgagtatgcttgatatgaacgtattgttaggcttaatgttgat |
4695925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 4695148 - 4695182
Alignment:
| Q |
1 |
cttatttcgttcgatatctattttccttgttaatc |
35 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4695148 |
cttatttcgttcgatatctatttgccttgttaatc |
4695182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 135
Target Start/End: Original strand, 4695725 - 4695763
Alignment:
| Q |
98 |
tgtatttgattctgttgttaaataa-ttagtgattattt |
135 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4695725 |
tgtatttgattctgttgttaaataatttagtgattattt |
4695763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3392 times since January 2019
Visitors: 8687