View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4547_low_9 (Length: 253)
Name: NF4547_low_9
Description: NF4547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4547_low_9 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 26 - 213
Target Start/End: Original strand, 39846244 - 39846431
Alignment:
Q |
26 |
atatacacaatatattgttcttattcctttcactgattgctctctcatgcccactcctagtgatttcaattatatcacttaaacagtgtgattgtgattc |
125 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39846244 |
atatatacaatatattgttcttattcctttcactgattgctctctcattcccactcctagtgatttcaattatatcacttaaacagtgtgattgtgattc |
39846343 |
T |
|
Q |
126 |
tagatgcttgttcatgtaattcagagtcatcaaaggttcaagggaatttgaatttcccttatccaaacaaatatcttatggaacttgc |
213 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39846344 |
tagatgcttgttcatgtaattcagagtcatcaaaggttcaagggaatttgaatttcccttatccaaacaaatatcttatggaacttgc |
39846431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2111 times since January 2019
Visitors: 8676