View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4548_high_2 (Length: 213)

Name: NF4548_high_2
Description: NF4548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4548_high_2
NF4548_high_2
[»] chr5 (1 HSPs)
chr5 (1-197)||(278100-278296)


Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 278296 - 278100
Alignment:
1 tctatggaaagacccatggaaatatagtcaaaagtggttactggattgttgttgaagcaacttgttgtggggaagaggttactggtatcagaggttgagc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||    
278296 tctatggaaagacccatggaaatatagtcaaaagtggttactggattgttgttgaaacaacttgttgtggggaagaggttactagtatcagaggttgagc 278197  T
101 taggaacttgtgcagtaactattgtggaatcatatggtggccaaaatgtagtttcagttccgaaattggaattttgatagaaatgttgtgagaatga 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
278196 taggaacttgtgcagtaactattgtggaatcatatggtggccaaaatgtagtttcagttccgaaattggaattttgatagaaatgttgtgagaatga 278100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2325 times since January 2019
Visitors: 8690