View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4548_low_1 (Length: 326)
Name: NF4548_low_1
Description: NF4548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4548_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 40783010 - 40782842
Alignment:
| Q |
1 |
tatggcactttttggacaaggtccaaccgctgcgcctgcggaggctcctgcaccgactaagccggagaaaagtgttcgggcttctgatgctccaaaaggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40783010 |
tatggcactttttggacaaggtccaaccgctgcgcctgcggaggctcctgcaccgactaagccggagaaaagtgttcgggcttctgatgctccaaaaggg |
40782911 |
T |
|
| Q |
101 |
tcttcagatagtccggctgatgattcgagtgctgttggtttgaatggctacatagttaatggtgctaca |
169 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40782910 |
tcttcggatagtccggctgatgattcgagtgctgttggtttgaatggctacatagttaatggtgctaca |
40782842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 282 - 317
Target Start/End: Complemental strand, 40782729 - 40782694
Alignment:
| Q |
282 |
ccttgagccagtttgagttgattgatgatgatgatg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40782729 |
ccttgagccagtttgagttgattgatgatgatgatg |
40782694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2288 times since January 2019
Visitors: 8690