View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4548_low_5 (Length: 213)
Name: NF4548_low_5
Description: NF4548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4548_low_5 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 278296 - 278100
Alignment:
Q |
1 |
tctatggaaagacccatggaaatatagtcaaaagtggttactggattgttgttgaagcaacttgttgtggggaagaggttactggtatcagaggttgagc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
278296 |
tctatggaaagacccatggaaatatagtcaaaagtggttactggattgttgttgaaacaacttgttgtggggaagaggttactagtatcagaggttgagc |
278197 |
T |
|
Q |
101 |
taggaacttgtgcagtaactattgtggaatcatatggtggccaaaatgtagtttcagttccgaaattggaattttgatagaaatgttgtgagaatga |
197 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
278196 |
taggaacttgtgcagtaactattgtggaatcatatggtggccaaaatgtagtttcagttccgaaattggaattttgatagaaatgttgtgagaatga |
278100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3611 times since January 2019
Visitors: 8709