View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4558-Insertion-8 (Length: 167)
Name: NF4558-Insertion-8
Description: NF4558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4558-Insertion-8 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 8 - 167
Target Start/End: Original strand, 8072764 - 8072923
Alignment:
| Q |
8 |
agtcaactgatagtgttgactttctatatcttgattaaccaatattggaaaatatactcgtatggtggataactttgccatgtgggtgagtttgaattct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8072764 |
agtcaactgatagtgttgactttctatatcttgattaaccaatattggaaaatatactcgtatggtggataactttgccatgtgggtgagtttaaattct |
8072863 |
T |
|
| Q |
108 |
taaaatacctacaggtattgcttgggtcaattattaggtacatatcactttctttgttca |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8072864 |
taaaatacctacaggtattgcttgggtcaattattaggtacatatcactttctttgttca |
8072923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3923 times since January 2019
Visitors: 8743