View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4562-Insertion-4 (Length: 375)
Name: NF4562-Insertion-4
Description: NF4562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4562-Insertion-4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 8 - 104
Target Start/End: Complemental strand, 40341140 - 40341044
Alignment:
| Q |
8 |
agaaggaccaagtagataaaatgaaagacaaagagaaccagaaacagcaaaacgacacaaatgaaagggacaagttcaccactaacggacatgcatg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40341140 |
agaaggaccaagtagataaaatgaaagacaaagagaaccagaaacagcaaaacgacacaaatgaaagggacaagttcaccactaacggacatgcatg |
40341044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 256 - 347
Target Start/End: Complemental strand, 40340893 - 40340798
Alignment:
| Q |
256 |
aaatattgttttgggttttatgttatatagctggaattggaatgggttgtacccattttctgtttcttg----aagattttattcgagtgatcctt |
347 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
40340893 |
aaatattattttgggttttatgttatatagctggaattggaatgggttgtacccattttctgtttcttgtataaagattttatttgagtgatcctt |
40340798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2319 times since January 2019
Visitors: 8690