View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4562-Insertion-7 (Length: 233)
Name: NF4562-Insertion-7
Description: NF4562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4562-Insertion-7 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 7 - 233
Target Start/End: Original strand, 19729666 - 19729889
Alignment:
| Q |
7 |
atgcttcactaccaaaccaacttatgtaaataagcgctttttcctattcacccttttcgctacttcttcaacctaaaacggaacctttctcacactacaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19729666 |
atgcttcactaccaaaccaacttatgtaaataagcgctttttcctattcacccttttcgctacttcttcaacctaaaacggaacctttctcacactataa |
19729765 |
T |
|
| Q |
107 |
agctggggagattattgggtttgttttcagccatgcgggtcacttctcagagtaccgtttttaggtcaacttactattgccccccttgtttctctttttc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19729766 |
agctggggagattattgggtttgttttcagccatgcgggtctcttctcagagtaccgcttttaggtcaacttactattgcccctcttgtttctctttttc |
19729865 |
T |
|
| Q |
207 |
ttcttcttcctcttccagaccctttcg |
233 |
Q |
| |
|
||||||||| ||| ||||||||||| |
|
|
| T |
19729866 |
ttcttcttcttct---agaccctttcg |
19729889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 7 - 233
Target Start/End: Original strand, 19750253 - 19750478
Alignment:
| Q |
7 |
atgcttcactaccaaaccaacttatgtaaataagcgctttttcctattcacccttttcgctacttcttcaacctaaaacggaacctttctcacactacaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19750253 |
atgcttcactaccaaaccaacttatgtaaataagccctttttcctattcacccttttcgctacttcttcaacctaaaacggaacctttctcacactataa |
19750352 |
T |
|
| Q |
107 |
agctggggagattattgggtttgttttcagccatgcgggtcacttctcagagtaccgtttttaggtcaacttactattgccccccttgtttctctttttc |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
19750353 |
agctgggg-tattattgggtttgttttcagccatgcgggtctcttctcagagtaccgcttttaggtcaactttttattgcccctcttgtttctctttttc |
19750451 |
T |
|
| Q |
207 |
ttcttcttcctcttccagaccctttcg |
233 |
Q |
| |
|
||||||||| ||||||||||||||||| |
|
|
| T |
19750452 |
ttcttcttcttcttccagaccctttcg |
19750478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2958 times since January 2019
Visitors: 8641