View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4562-Insertion-9 (Length: 51)
Name: NF4562-Insertion-9
Description: NF4562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4562-Insertion-9 |
| |
|
[»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 44; Significance: 6e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 6e-17
Query Start/End: Original strand, 8 - 51
Target Start/End: Complemental strand, 28935622 - 28935579
Alignment:
Q |
8 |
ggtaaatctctgctaactatgctttttattgcttttcttttaca |
51 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28935622 |
ggtaaatctctgctaactatgctttttattgcttttcttttaca |
28935579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3409 times since January 2019
Visitors: 8687