View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4562_high_15 (Length: 246)
Name: NF4562_high_15
Description: NF4562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4562_high_15 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 45123309 - 45123546
Alignment:
Q |
1 |
actagtctatgtgttgtaaaagtttgcatatagtattattttctagttgttattggacaatgatcatagtttcgtctccgctttttgaagtttccaccta |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
45123309 |
actagtctatgtgttgtaaaagtttgcatatagtattattttctagttgtcattggacaatgatcatagtttcgtctccgctttttgaagtttctaccta |
45123408 |
T |
|
Q |
101 |
tgttgtgattgtgtttctttattttctctatgttgatcttttccaacacaattttgtcttcaactatgaaaaatgtttctcaaatgtatccttctatgaa |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
45123409 |
tgttgtgattgtgtttctttattttctctatgttgatcttttccaacacaattttgtcttcaactatgaaaaatgtttctcaaatatatccttctatgaa |
45123508 |
T |
|
Q |
201 |
tgtctattacagaatattatgaatattagtgatgatgt |
238 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||| |
|
|
T |
45123509 |
tgtctattacaaaatattatgaatattagtgatgatgt |
45123546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 14 - 61
Target Start/End: Complemental strand, 22190691 - 22190644
Alignment:
Q |
14 |
ttgtaaaagtttgcatatagtattattttctagttgttattggacaat |
61 |
Q |
|
|
|||||||| |||||||||||| ||||| ||||||||| |||||||||| |
|
|
T |
22190691 |
ttgtaaaaatttgcatatagtgttattctctagttgtcattggacaat |
22190644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2450 times since January 2019
Visitors: 8707