View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4562_low_11 (Length: 366)
Name: NF4562_low_11
Description: NF4562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4562_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 173 - 352
Target Start/End: Original strand, 28679050 - 28679234
Alignment:
| Q |
173 |
gggggcggtgaaaggacagtcgcgtgaccagtgacctggtctgccgcatttgtaacaacctgttgctgttccggatcctgacattttctct----tctct |
268 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28679050 |
gggggaggtgaaaggacagtcgcgtgaccagtgaccaggtctgccgcatttgtaacaacctgttgctgttccggatcctgacattttctctcttctctct |
28679149 |
T |
|
| Q |
269 |
ctcgaatgtgtattgaaaatgggatttatcaagattgaaattttgctcc-gtacttgcgcgggaaatggcgggaaaatgtttgat |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28679150 |
ctcgaatgtgtattgaaaatgggatttatcaagattgaaattttgctccagtacttgcgcgggaaatggcgggaaaatgtttgat |
28679234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 10 - 105
Target Start/End: Original strand, 28678878 - 28678973
Alignment:
| Q |
10 |
catcatcagatagaagaagctcgggagtgagtttggggcgggtacgtggaggctttttgggtttttcgacggcggatctgggtccggagggtttga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28678878 |
catcatcagatagaagaagctcgggagtgagtttggggcgggtacgtggaggctttttgggtttttcgacagcggatctgggtccggagggtttga |
28678973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4267 times since January 2019
Visitors: 8757