View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4562_low_24 (Length: 236)
Name: NF4562_low_24
Description: NF4562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4562_low_24 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 43289094 - 43288892
Alignment:
Q |
16 |
tatactttgcaataagacggagagattaagaaagaagggcatctttatattctttattacaatcagtgtcttgagtgaggaaaacacatagatcttttca |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43289094 |
tatactttgcaataagacggagagattaagaaagaagggcatctttatattctttattacaatcagtgtcttgagtgaggaaaacacatagatcttttca |
43288995 |
T |
|
Q |
116 |
ttattattatatgtattggaattagaatgctttttgaaatgaaaaatgtttattaaagaggtttttactcctttggtagttgagatggcttggaagatgc |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43288994 |
ttattattatatgtattggaattagaatgctttttgaaatgaaaaatgtttattaaagaggtttttactcctttggtagttgagatggcttggaagatgc |
43288895 |
T |
|
Q |
216 |
cat |
218 |
Q |
|
|
||| |
|
|
T |
43288894 |
cat |
43288892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3836 times since January 2019
Visitors: 8728