View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4562_low_28 (Length: 205)
Name: NF4562_low_28
Description: NF4562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4562_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 41376005 - 41375833
Alignment:
| Q |
18 |
cattaagctcctcttgtggctgttattaccgctcccttcttattannnnnnnnctcgttagaactttgaaatatcaacaataagttgtaagatccaaatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41376005 |
cattaagctcctcttgtggctgttattacccctcccttcttattattttttttctcgttagaactttgaaatatcaacaataagttgtaagatccaaatc |
41375906 |
T |
|
| Q |
118 |
aatccgtttctcttacaaatgtttgccacctcttcatgtcaaaaagcttaaaaatccaatatgttttcatgat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41375905 |
aatccgtttctcttacaaatgtttgccacctcttcatgtcaaaaagcttaaaaatccaatatgttttcatgat |
41375833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2164 times since January 2019
Visitors: 8677