View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4563_low_10 (Length: 231)
Name: NF4563_low_10
Description: NF4563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4563_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 73 - 210
Target Start/End: Original strand, 41040653 - 41040790
Alignment:
| Q |
73 |
caaatgcagttattataagtaacagcttgtaagaaaatgtgtacatagacggagtgagtttattgatatgataattaccagctgagcaggactaggctga |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41040653 |
caaatgcagttattataagtaacagcttgtaagaaaatgtgtacgtagacggagtgagtttattgatatgataattaccagctgagcaggactaggctga |
41040752 |
T |
|
| Q |
173 |
aagaagatggctaatgcataagccataccagtgacaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41040753 |
aagaagatggctaatgcataagccataccagtgacaca |
41040790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3990 times since January 2019
Visitors: 8743