View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4563_low_5 (Length: 315)
Name: NF4563_low_5
Description: NF4563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4563_low_5 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 113 - 295
Target Start/End: Original strand, 39809454 - 39809636
Alignment:
Q |
113 |
accaaagtttgaactcttaattagtcttctacattttttgagtgtttcagctcaaacacttgatttgtttggtgaaactagtagagtactaatgaggcat |
212 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39809454 |
accaaagtttgaactcttaattagtcttctacattttttgagtgtttcagctcaaacacttgatttgtttggtgaaactagtagagtactaatgaggcat |
39809553 |
T |
|
Q |
213 |
actttgtaggtggaaggagaggaacttcaaaggttagcatacagaagatgggaaagagagcaaggacgaagggatgcaacaga |
295 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39809554 |
actttgtaggtggaaggagaggaacttcaaaggttagcatacagaagatgggaaagagagcaaggacgaagggatgcaacaga |
39809636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3526 times since January 2019
Visitors: 8698