View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4563_low_7 (Length: 301)
Name: NF4563_low_7
Description: NF4563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4563_low_7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 11 - 301
Target Start/End: Complemental strand, 24361827 - 24361536
Alignment:
| Q |
11 |
cacagatattatcattagtacgtcatcaggatgtattaattaacctccaaaaacaaagtagattttgagttctctaattcaacttgtttttcaggttgaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24361827 |
cacagatattatcattagtacgtcatcaggatgtattaattaacctccaaaaacaaagtagattttgagttctctaattcaacttgtttttcaggttgaa |
24361728 |
T |
|
| Q |
111 |
atggtaattatacaaggaaattgttcatacatttatatgcatgttttccttgcttttaaaagatagtctaaaaagtcaaattctggttgcaccatttctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24361727 |
atggtaattatacaaggaaattgttcatacatttatatgcatgttttccttgcttttaaaagatagtctaaaaagtcaaattctggttgcaccatttctt |
24361628 |
T |
|
| Q |
211 |
tcttccnnnnnnnagcatg-ttcacctttctttgggaaataatatgattgacaaagccatagaagattaaagtaatcactttcttcaatctc |
301 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24361627 |
tcttcctttttttagcatgattcacctttctttgggaaataatatgcttgacaaaaccatagaaggttaaagtaatcactttcttcaatctc |
24361536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3624 times since January 2019
Visitors: 8709