View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4563_low_8 (Length: 232)
Name: NF4563_low_8
Description: NF4563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4563_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 24361524 - 24361303
Alignment:
| Q |
1 |
ctctgctgtttactattttatcaataaagtcaccattattcctctacagaattaaatctggtgcatatatgtttctgccatagttggtnnnnnnnnttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24361524 |
ctctgctgtttactattttatcaataaagtcaccattattcctctacaaaattacatctggtgcatatatgtttctgccatagttggtaaaaaaaattga |
24361425 |
T |
|
| Q |
101 |
aggatatataatatnnnnnnngtactcaaatctaaaacaattaatgttatgtgtgtagatatgaaaattacacatgaatgagatatacaaaactacgaac |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24361424 |
aggatatataatataaaaaaagtactcaaatctaaaacaattaatgttgtgtgtgtagatatgaaaattacacatgaatgagatatacaaaactacgaac |
24361325 |
T |
|
| Q |
201 |
caggattctttaatgttgtttt |
222 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
24361324 |
cagaattctttaatgttgtttt |
24361303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4130 times since January 2019
Visitors: 8754