View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4563_low_9 (Length: 231)
Name: NF4563_low_9
Description: NF4563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4563_low_9 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 214
Target Start/End: Complemental strand, 36171861 - 36171663
Alignment:
Q |
16 |
cagaataatgactccacagtttcaagcgtcgaagatgttctaatcatcatcaagtctgattatgacaatgattactttgttacaggtacctcgttttatc |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36171861 |
cagaataatgactccacagtttcaagcgtcgaagatgttctaatcatcatcaagtctgattatgacaatgattactttgttacaggtacctcgttttatc |
36171762 |
T |
|
Q |
116 |
tttcaatttccgtcttagcagatattttgtcagaaggttgctcttactctctaatttagcatgtttttgctattagtttttattcaatatcagcttctt |
214 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36171761 |
tttcaatttccgtcttagcagatattttgtcagaaggttgctcttactctctaatttagcatgtttttgctattagtttttattcaatatcagcttctt |
36171663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4269 times since January 2019
Visitors: 8757