View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4565-Insertion-12 (Length: 281)
Name: NF4565-Insertion-12
Description: NF4565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4565-Insertion-12 |
| |
|
[»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 8 - 281
Target Start/End: Original strand, 33817370 - 33817648
Alignment:
Q |
8 |
gtggataatggtgatttagagttgatgtcaagcactagaagctgtgatgttccatttcatactttgtatgcagatcacataatgatatttcgcaatggga |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
33817370 |
gtggataatggtgatttagagttgatgtcaagcactagaagttgtgatgttccatttcatactttgtatgcagatcacataatgatatttagcaatggga |
33817469 |
T |
|
Q |
108 |
aggcatcttgcataaattcactgataaaccttttcactagatatgcacaggtttctggtca-gtggtcagcaatagcaaatcaactattttctcggggtc |
206 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
33817470 |
aggcatcttgcataaattcactgataaaccttttcactagatatgcacaggtttctggtcaggtggtcagcaatagcaaatcaactattttctcggggtc |
33817569 |
T |
|
Q |
207 |
aatctct----ataatagattacaacatattgttgaccttattggttttcaagtgggttctctaccattcattttgtca |
281 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
33817570 |
aatctctaataataatagattacaacatattgttgaccttactggttttcaagtgggttctctaccattcattttgtca |
33817648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2160 times since January 2019
Visitors: 8677