View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4565-Insertion-14 (Length: 119)
Name: NF4565-Insertion-14
Description: NF4565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4565-Insertion-14 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 46; Significance: 1e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 50 - 95
Target Start/End: Original strand, 43351362 - 43351407
Alignment:
Q |
50 |
aattgaattgaatgtcataatatcacacatcgctgtctcactcact |
95 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43351362 |
aattgaattgaatgtcataatatcacacatcgctgtctcactcact |
43351407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3291 times since January 2019
Visitors: 8679