View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4565_high_11 (Length: 251)
Name: NF4565_high_11
Description: NF4565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4565_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 49541632 - 49541394
Alignment:
| Q |
1 |
tttattgcctgctaggaatttctcatgaaataataacttcatattatcttaaatttaattnnnnnnngaaccaaacaacaactcatcagacattggggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
49541632 |
tttattgcctgctaggaatttctcatgaaataataacttcatattatcttaaatttaattaaaaaaagaaccaaacaacaactcatcagacattgtggta |
49541533 |
T |
|
| Q |
101 |
tatcaatactttgtttggtaataacgtttctaatcgaacttatgttcagtgtccgacactaacatgacactcatatatgtaattaaattcaactataann |
200 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||||||||| | ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49541532 |
tttcagtactttgtttggtaataacgtttctaatcgaacgtgtgtccagtgtctgacactaacatgacactcatatatgtaattaaattcaactataa-- |
49541435 |
T |
|
| Q |
201 |
nnnnnnnncttcaaattattaataatatcagcgtatctgtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49541434 |
ttttttttcttcaaattattaataatatcagcgtatctgtg |
49541394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3085 times since January 2019
Visitors: 8656