View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4565_high_14 (Length: 232)
Name: NF4565_high_14
Description: NF4565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4565_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 46 - 155
Target Start/End: Original strand, 3914769 - 3914880
Alignment:
| Q |
46 |
aatacctgctacttttcatagcttggagagaatgacttctctgtaagtttctccttgaa--nnnnnnnngaactcgtaattctatcatgcatgaagagta |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
3914769 |
aatacctgctacttttcatagcttggagagtatgacttctctgtaagtttctccttgaaatttttttttgaacttgtaattctatcatgcatgaagagta |
3914868 |
T |
|
| Q |
144 |
gccttgattgga |
155 |
Q |
| |
|
| |||||||||| |
|
|
| T |
3914869 |
gtcttgattgga |
3914880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 151 - 215
Target Start/End: Original strand, 3915376 - 3915440
Alignment:
| Q |
151 |
ttggaacatcttctgaagctgtgagttatctgcttagttattatttcttggaatctttactgttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3915376 |
ttggaacatcttctgaagctgtgagttatttgcttagttattatttcttggaatctttattgttt |
3915440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 46 - 103
Target Start/End: Complemental strand, 34959591 - 34959534
Alignment:
| Q |
46 |
aatacctgctacttttcatagcttggagagaatgacttctctgtaagtttctccttga |
103 |
Q |
| |
|
||||||| ||||| |||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
34959591 |
aataccttctactcttcatagcttcgagagtatgacttctctgtaagtttctccttga |
34959534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3972 times since January 2019
Visitors: 8743