View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4565_high_9 (Length: 268)
Name: NF4565_high_9
Description: NF4565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4565_high_9 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 984038 - 983799
Alignment:
Q |
11 |
aatgatcggccctgaaccagaactatttttagagaaagccaaactacattgtttttgaactgaaactaaactaaaatagttcaatttagttttcgttttt |
110 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
984038 |
aatgattggccctgaaccagaactatttttagagaaagccaaactacattgtttttgaactgaaactaaactaaaatagttcaatttagttttcattttt |
983939 |
T |
|
Q |
111 |
taacaatcctagtagtaaatgtgagtaagaagtcccatattagatgaaaatgtcaatattgaataatatagatgagacgacctatatatccaatgtcttg |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
983938 |
taacaatcctagtagtaaatgtgagtaagaagtcccatattagatgaaaatgtcaatattgaataatatagatgagacgacctatatatccaatgttttg |
983839 |
T |
|
Q |
211 |
taaggttttaggtaaagatgtagcaaatagttgctcatag |
250 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
983838 |
taaggttttaggtaaagatgtagcaaatagttgctcatag |
983799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2420 times since January 2019
Visitors: 8707