View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4565_low_16 (Length: 227)
Name: NF4565_low_16
Description: NF4565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4565_low_16 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 110 - 221
Target Start/End: Original strand, 47455777 - 47455888
Alignment:
Q |
110 |
gtgaaccaatttgcaaattgtagagacctatctctnnnnnnntaatttttaggaaccaatattttgtaaatcagcagcgagtttagaatttgcaaatttt |
209 |
Q |
|
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47455777 |
gtgaaccaatttgcaaattgtagggacctatctctaaaaaaataatttttaggaaccaatattttgtaaatcagcagcgagtttagaatttgcaaatttt |
47455876 |
T |
|
Q |
210 |
tcgtaatgtttt |
221 |
Q |
|
|
|||| ||||||| |
|
|
T |
47455877 |
tcgtgatgtttt |
47455888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 47455680 - 47455776
Alignment:
Q |
1 |
aattttggcagtatattttgtggatagacaaactgtc-------------acatagatatttccaatataagagttttaaaagttttcaaaaagtta |
84 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47455680 |
aattttggcagtatattttgtggatagacaaactgtctccctgttagtcaacatagatatttccaatataagagttttaaaagttttcaaaaagtta |
47455776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3235 times since January 2019
Visitors: 8678