View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4565_low_6 (Length: 288)
Name: NF4565_low_6
Description: NF4565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4565_low_6 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 7045481 - 7045209
Alignment:
Q |
1 |
tgttagaattagaggaaagatgaatcaaaatttactaaaaacagattgatgaaaccaacaattgcattgtattataactttaactatctgaaatatagga |
100 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
7045481 |
tgttagaattagaggatagatgaatcaaaatttactaaaaacagattgatgaaaccaacaattgcatggtattataactttaactatctgaaatatagga |
7045382 |
T |
|
Q |
101 |
ccaattatgatttattcttataaatttattacttatgaaacaggaattagttcgagtgacgtagctacatttggagttggtgctgttcaggttcttgcca |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7045381 |
ccaattatgatttattcttataaatttattacttatgaaacaggaattagttcgagtgacgtagctacatttggagttggtgctgttcaggttcttgcca |
7045282 |
T |
|
Q |
201 |
ccactttaactttgtggttggcagacaaatccggtcgtcggctcctacttattgtgagtctt-aactttttct |
272 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
7045281 |
ccactttaactttgtggttggcagacaaatccggtcgtcggctcctacttattgtgagtcttaaactttttct |
7045209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2964 times since January 2019
Visitors: 8641