View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4565_low_7 (Length: 288)
Name: NF4565_low_7
Description: NF4565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4565_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 71 - 151
Target Start/End: Original strand, 5777275 - 5777355
Alignment:
| Q |
71 |
catcgtccatgttcctccgggagaagagtaatgttccattgctctatccttacaccttcgcttcaattcgatccctctttt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5777275 |
catcgtccatgttcctccgggagaagagtaatgttccattgctctatccttacaccttcgcttcaattcgatccctctttt |
5777355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 202 - 271
Target Start/End: Original strand, 5777679 - 5777748
Alignment:
| Q |
202 |
tatttctatatcattaataacattgtgatttaatttttagcatcaaatagaattggattcatagtcttgg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5777679 |
tatttctatatcattaataacattgtgatttaatttttagcatcaaatagaattggattcatagtcttgg |
5777748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3809 times since January 2019
Visitors: 8728