View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4566_low_2 (Length: 241)
Name: NF4566_low_2
Description: NF4566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4566_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 35228362 - 35228583
Alignment:
| Q |
1 |
tgctcatatcccttaattttagcaacattgtaggttcctttcctaacattgcatttaccatcaactcttgtataagggtaatttgtttcacttgttattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35228362 |
tgctcatatcccttaattttagcaacattgtaggttcctttcctaacattgcatttaccatcaacccttgtataagggtaatttgtttcacttgttattc |
35228461 |
T |
|
| Q |
101 |
ctccttttttaactatgaaatcacaagcatcttctacataaccaccattgcatccatcagttgtattagttttcacacaatccactagctcttgctcaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35228462 |
ctccttttttaactatgaaatcacaagcatcttctacataaccaccattgcatccatcagttgtattagttttgacacaatccactagctcttgctcaga |
35228561 |
T |
|
| Q |
201 |
gagtgatactaatcttcctgtg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35228562 |
gagtgatactaatcttcctgtg |
35228583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5344 times since January 2019
Visitors: 7845