View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5291-Insertion-9 (Length: 60)
Name: NF5291-Insertion-9
Description: NF5291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5291-Insertion-9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 53; Significance: 3e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 8 - 60
Target Start/End: Complemental strand, 37835022 - 37834970
Alignment:
| Q |
8 |
gtagtctggtggaggatgttattcgttgtacttttctctttaagcgtagggcc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37835022 |
gtagtctggtggaggatgttattcgttgtacttttctctttaagcgtagggcc |
37834970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3080 times since January 2019
Visitors: 8656