View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5291_low_4 (Length: 354)
Name: NF5291_low_4
Description: NF5291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF5291_low_4 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 64; Significance: 6e-28; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 12 - 83
Target Start/End: Complemental strand, 26738362 - 26738291
Alignment:
Q |
12 |
atgaatgaaaagactatgatacatttcatttagtggaaatgaatctgtagtgactatgaaacatatatcaat |
83 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
26738362 |
atgaatgaaaagactatcatacatttcatttagtggaaatgaatctttagtgactatgaaacatatatcaat |
26738291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 258 - 340
Target Start/End: Complemental strand, 26737960 - 26737878
Alignment:
Q |
258 |
tatttatatttgtgagtataacctctnnnnnnnntgtatacacgcacgacacgcatgcttttggcagacaaaggatatatatt |
340 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26737960 |
tatttatatttgtgagtataacctctaaaaaaaatgtatacacgcacgacacgcatgcttttggcagacaaaggatatatatt |
26737878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 151 - 256
Target Start/End: Complemental strand, 26738218 - 26738117
Alignment:
Q |
151 |
gcatactaacaaatccacaatcatagctcaaatggtnnnnnnnnntaatgtggacattatttggccggatagcgtgattagggtttgaacattggctact |
250 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||| ||| |||| |||||||||||| | | ||||||||||||||||||| |||| || |
|
|
T |
26738218 |
gcatactaacaagtccacaatcatagctcaaatggtaaaaaa----aatatggaaattatttggccgaacaatgtgattagggtttgaacatcggctcct |
26738123 |
T |
|
Q |
251 |
ctattt |
256 |
Q |
|
|
|||||| |
|
|
T |
26738122 |
ctattt |
26738117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3265 times since January 2019
Visitors: 8679