View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5291_low_6 (Length: 288)
Name: NF5291_low_6
Description: NF5291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5291_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 13 - 273
Target Start/End: Original strand, 2098771 - 2099031
Alignment:
| Q |
13 |
aatattgctagattaggctcatgatcatgcattagtctcttatgtactcactatagtaatcaatatgtgttatatggttgcacttaattttagcaagaac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2098771 |
aatattgctagattaggctcatgatcatgcattagtctcttatgtactcactatagtaatcaatatgtgttatatggttgcacttaattttagcaagaac |
2098870 |
T |
|
| Q |
113 |
tggattgtcattttgctgcttaataagaaagttatggtatgcagctttagggtgtaatttgcttaataagatagtttaagacttttcataaacaatctct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2098871 |
tggattgtcattttgctgcttaataagaaagttatggtatgcagctttagggtgtaatttgcttaataagatagtttaagacttttcttaaacaatctct |
2098970 |
T |
|
| Q |
213 |
tcaattctagcttacaagtctttatatttttaccctaaccgttaacaaatgccgtgttttt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2098971 |
tcaattctagcttacaagtctttatatttttaccctaaccgttaacaaatgccgtgttttt |
2099031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 203 - 271
Target Start/End: Original strand, 2107119 - 2107187
Alignment:
| Q |
203 |
aacaatctcttcaattctagcttacaagtctttatatttttaccctaaccgttaacaaatgccgtgttt |
271 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||| ||||||| ||| |||||||||| || ||||| |
|
|
| T |
2107119 |
aacaatcttttcaattatagattacaagtctttatacttttacctcaactgttaacaaataccatgttt |
2107187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4000 times since January 2019
Visitors: 8743