View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5291_low_7 (Length: 271)
Name: NF5291_low_7
Description: NF5291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF5291_low_7 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 73 - 252
Target Start/End: Original strand, 39292792 - 39292971
Alignment:
Q |
73 |
cctgatgtagtgcatcactcttaaggatagtttcgtgagggagatgaatgttttgctctttcttttcattattggcagccatatctctctctagtgtgtt |
172 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39292792 |
cctgatgtagtgcatcactcttaaggatagtttcgtgagggagatgaatgttttgctctttcttttcattattggcagccatatctctctctagtgtgtt |
39292891 |
T |
|
Q |
173 |
tacttatcttaattttcttgaactatgaaaagctctctcaatgatgaaacttaatgctccaaaaagctgttggcgagtgt |
252 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
39292892 |
tacttatcttaattttcttggactatgaaaagctctctcaatgatgaaacttaatgctccaaaaagctgtcggcgagtgt |
39292971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 51
Target Start/End: Original strand, 39292740 - 39292782
Alignment:
Q |
9 |
tcgaagaatatttacggtagaagaagatggaaaagaatagtag |
51 |
Q |
|
|
||||| || |||||||||||||||||| ||||||||||||||| |
|
|
T |
39292740 |
tcgaacaagatttacggtagaagaagaaggaaaagaatagtag |
39292782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3953 times since January 2019
Visitors: 8743