View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5291_low_8 (Length: 235)
Name: NF5291_low_8
Description: NF5291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5291_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 95 - 220
Target Start/End: Complemental strand, 39292209 - 39292080
Alignment:
| Q |
95 |
taatgttttaaatgaatctcaattactcaaatcttgaaagtttacacataaagatgtattaattaattaat----gacatacacgattgatgttgtaaaa |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39292209 |
taatgttttaaatgaatctcaattactcatatcttcaaagtttacacataaagatgtattaattaattaattaatgacatacacgattgatgttgtaaaa |
39292110 |
T |
|
| Q |
191 |
caggtatatgatggctacacccggtgatga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39292109 |
caggtatatgatggctacacccggtgatga |
39292080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2422 times since January 2019
Visitors: 8707