View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-L2_15 (Length: 122)
Name: R108-L2_15
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] R108-L2_15 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 8e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 8e-34
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 34668245 - 34668341
Alignment:
Q |
1 |
ctgataccacattaagtatgattatttgattatctttcttgttcataacttttagcagtttatattgatgtacaattctgatttgtaggcaattgta |
97 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| || |||||||||||||||| |||||||||| |||||||| |
|
|
T |
34668245 |
ctgataccacattaagtatgattatttgattatctttcttgttcaaaactgttagcaattaatattgatgtacaattttgatttgtagacaattgta |
34668341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13032 times since January 2019
Visitors: 8270